View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10579_low_78 (Length: 247)
Name: NF10579_low_78
Description: NF10579
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10579_low_78 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 18 - 241
Target Start/End: Complemental strand, 8416224 - 8416001
Alignment:
| Q |
18 |
aaaagctcctagtggtggaagcaatgcagctagggattcaaggatcggaaaggttaggattaggctctcaacacttgaagctaatagaatttacacaaac |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8416224 |
aaaagctcctagtggtggaagcaatgcagctagggattcaaggatcggaaaggttaggattaggctctcaacacttgaagctaatagaatttacacaaac |
8416125 |
T |
|
| Q |
118 |
tcttatccacttcttgttttgcatcaaaatggtgtcaagaaaatgggtgagcttcaactagcaataaggttcactactctttcaatagctaacatggttt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8416124 |
tcttatccacttcttgttttgcatcaaaatggtgtcaagaaaatgggtgagcttcaactagcaataaggttcactactctttcaatagctaacatggttt |
8416025 |
T |
|
| Q |
218 |
atatttatggacaacctttgcttc |
241 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
8416024 |
atatttatggacaacctttgcttc |
8416001 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 89; Significance: 5e-43; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 52 - 236
Target Start/End: Complemental strand, 7915752 - 7915568
Alignment:
| Q |
52 |
gattcaaggatcggaaaggttaggattaggctctcaacacttgaagctaatagaatttacacaaactcttatccacttcttgttttgcatcaaaatggtg |
151 |
Q |
| |
|
|||||||| || |||||||| ||||||||||| |||||||||||||| |||| ||||||||| || |||||||||||||||||||| || ||| |||| | |
|
|
| T |
7915752 |
gattcaagaattggaaaggtaaggattaggctatcaacacttgaagccaataaaatttacaccaattcttatccacttcttgttttacaccaacatggag |
7915653 |
T |
|
| Q |
152 |
tcaagaaaatgggtgagcttcaactagcaataaggttcactactctttcaatagctaacatggtttatatttatggacaaccttt |
236 |
Q |
| |
|
| ||||||||||||||||||||||| || | ||||||||| | || ||| ||||||||||| || |||||||||| |||||||| |
|
|
| T |
7915652 |
ttaagaaaatgggtgagcttcaactcacagtgaggttcactgcactctcactagctaacatgtttcatatttatggccaaccttt |
7915568 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University