View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10579_low_80 (Length: 245)
Name: NF10579_low_80
Description: NF10579
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10579_low_80 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 139; Significance: 7e-73; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 17 - 176
Target Start/End: Complemental strand, 20693199 - 20693034
Alignment:
| Q |
17 |
tgatagtggtggaaaacattggggttgttctgagatggggtttgaagaaagttttgggttt------cagagttggtgatggacggttgatattgcaaga |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
20693199 |
tgatagtggtggaaaacattggggttgttctgagatggggtttgaagaaagttttgggtttgggtttcagagttggtgatggacggttgatattgcaaga |
20693100 |
T |
|
| Q |
111 |
ggaaactgtttggaagaagaagaaggaagtggtgggcttttcagattgggctttctaattgctctt |
176 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
20693099 |
ggaaactgtttggaagaagaagaaggaagtgctgggcttttcagattgggctttctaattgctctt |
20693034 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University