View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10579_low_86 (Length: 241)
Name: NF10579_low_86
Description: NF10579
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10579_low_86 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 19 - 241
Target Start/End: Complemental strand, 42813480 - 42813248
Alignment:
| Q |
19 |
atattgactagctatcaatatcatttatcaacatattcaacacata---------gtccattggttaaatattttgttgcttacttagttgtcatcttcc |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42813480 |
atattgactagctatcaatatcatttatcaacatattcaacacatacaccacatagtccattggttaaatattttgttgcttacttagttgtcatcttcc |
42813381 |
T |
 |
| Q |
110 |
aaactgttagccattggttttttgtcttaaccctctggttcttagaagaaatgaattccaataatcccgagttcaatcgaggtaagtaaagtctaattat |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||| || |||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
42813380 |
aaactgttagccattggttttttgtcttaaccctctggttcttagaagaaataaatcccgataatcccgagttcgatcgaggtaagtaaagtctaattat |
42813281 |
T |
 |
| Q |
210 |
gaat-tgttctagttaaaatttaaactcgaata |
241 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| |
|
|
| T |
42813280 |
gaatctgttctagttaaaatttaaactcgaata |
42813248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University