View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10579_low_99 (Length: 237)
Name: NF10579_low_99
Description: NF10579
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10579_low_99 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 17 - 204
Target Start/End: Original strand, 32897803 - 32897997
Alignment:
| Q |
17 |
ggtgataagaggtcacattgacccgttaaaacttaaactttatttgatacagt-ataaatttagatcat------atgacacagtgtttagatacatctt |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||| |||||| |||||||||||||||||| |
|
|
| T |
32897803 |
ggtgataagaggtcacattgacccgttaaaacttaaactttatttgatacagtgaaaaatttagatcatcacaaaatgacagagtgtttagatacatctt |
32897902 |
T |
 |
| Q |
110 |
tatgagatagaattacacacattcaagctctttatgtagtctaccaaaaagggtttcaaaaaccaagtagatatcataattggtcaccactatag |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
32897903 |
tatgagatagaattacacacattcaagctctttatgtagtctaccaaaaagggtttcaaaaaccaagtagatatcataattggtcaccaccatag |
32897997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University