View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10580_high_10 (Length: 280)
Name: NF10580_high_10
Description: NF10580
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10580_high_10 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 18 - 272
Target Start/End: Original strand, 181123 - 181377
Alignment:
| Q |
18 |
acgttgatgcgcggttcaagtaacagtgatctctacacctttcattatatgtctcaatatcaacccactactcttgcttccacctgctctgcctcccctt |
117 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||| |||| |
|
|
| T |
181123 |
acgttgatgcgcggttccagtaacagtgatctctacacctttcattatatgtctcaatatcaacccactgctcttgcttccacttgctctgcctcacctt |
181222 |
T |
|
| Q |
118 |
ctatatggcatgctcgtttcgggcatccctctttcagagttcttgcactaatgatgtctagttgtggcagttttaggaacttagaaaatnnnnnnnttca |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
181223 |
ctatatggcatgctcgtttcgggcatccctctttcagagttcttgcactaatgatgtctagttgtggcaattttaggaacttagaaaataaaaaatttca |
181322 |
T |
|
| Q |
218 |
ttgtaattcttgtcatattaataaaagtcataagcttcctttttcagtttcttct |
272 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
181323 |
ttgtaattcttgtcatattaataaaagtcataagcttcctttttcagtttcttct |
181377 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 18 - 272
Target Start/End: Original strand, 1701550 - 1701804
Alignment:
| Q |
18 |
acgttgatgcgcggttcaagtaacagtgatctctacacctttcattatatgtctcaatatcaacccactactcttgcttccacctgctctgcctcccctt |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||| ||||||||||||||||||| |||||||||| |
|
|
| T |
1701550 |
acgttgatgcgcggttcaagtaacagtgatctctacacctttcatcctaagtctcaatatcaacccactgctcttgcttccacctgctccgcctcccctt |
1701649 |
T |
|
| Q |
118 |
ctatatggcatgctcgtttcgggcatccctctttcagagttcttgcactaatgatgtctagttgtggcagttttaggaacttagaaaatnnnnnnnttca |
217 |
Q |
| |
|
|| ||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||| |||||||| ||||||||| ||||||||| |||| |
|
|
| T |
1701650 |
ctttatggcatgctcgtttcggtcatccctctttcagagttcttgcacaaatgatgtctacttgtggcaattttaggaatttagaaaataaaaaatttca |
1701749 |
T |
|
| Q |
218 |
ttgtaattcttgtcatattaataaaagtcataagcttcctttttcagtttcttct |
272 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
1701750 |
ttgtaattcttgccatattaataaaagtcataagcttcctttttctgtttcttct |
1701804 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University