View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10580_high_9 (Length: 287)
Name: NF10580_high_9
Description: NF10580
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10580_high_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 139; Significance: 9e-73; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 139; E-Value: 9e-73
Query Start/End: Original strand, 84 - 222
Target Start/End: Original strand, 8416900 - 8417038
Alignment:
| Q |
84 |
aatggacaagtgtcgataaaatatgatgttgtcataggttttatttgaaagttggcactgaattgtttgttgattaacgagcaacaagttcctataagaa |
183 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8416900 |
aatggacaagtgtcgataaaatatgatgttgtcataggttttatttgaaagttggcactgaattgtttgttgattaacgagcaacaagttcctataagaa |
8416999 |
T |
 |
| Q |
184 |
tgagtcaggattcgagctgctctctgcatagatttatta |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8417000 |
tgagtcaggattcgagctgctctctgcatagatttatta |
8417038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 239 - 272
Target Start/End: Original strand, 8417037 - 8417070
Alignment:
| Q |
239 |
tattagattttgctgcaagctttcaagaaatatg |
272 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| |
|
|
| T |
8417037 |
tattagattttgctgcaagcattcaagaaatatg |
8417070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University