View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10580_high_9 (Length: 287)

Name: NF10580_high_9
Description: NF10580
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10580_high_9
NF10580_high_9
[»] chr1 (2 HSPs)
chr1 (84-222)||(8416900-8417038)
chr1 (239-272)||(8417037-8417070)


Alignment Details
Target: chr1 (Bit Score: 139; Significance: 9e-73; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 139; E-Value: 9e-73
Query Start/End: Original strand, 84 - 222
Target Start/End: Original strand, 8416900 - 8417038
Alignment:
84 aatggacaagtgtcgataaaatatgatgttgtcataggttttatttgaaagttggcactgaattgtttgttgattaacgagcaacaagttcctataagaa 183  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8416900 aatggacaagtgtcgataaaatatgatgttgtcataggttttatttgaaagttggcactgaattgtttgttgattaacgagcaacaagttcctataagaa 8416999  T
184 tgagtcaggattcgagctgctctctgcatagatttatta 222  Q
    |||||||||||||||||||||||||||||||||||||||    
8417000 tgagtcaggattcgagctgctctctgcatagatttatta 8417038  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 239 - 272
Target Start/End: Original strand, 8417037 - 8417070
Alignment:
239 tattagattttgctgcaagctttcaagaaatatg 272  Q
    |||||||||||||||||||| |||||||||||||    
8417037 tattagattttgctgcaagcattcaagaaatatg 8417070  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University