View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10580_low_14 (Length: 293)
Name: NF10580_low_14
Description: NF10580
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10580_low_14 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 128; Significance: 3e-66; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 102 - 265
Target Start/End: Complemental strand, 19235343 - 19235181
Alignment:
| Q |
102 |
tgggaagagagcatctgttctctgaataagcttagcactgggcaacacctaacgaactatattactgcttgcaactggctatcttttaaaccttgtagct |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||| |||||||||| ||| |
|
|
| T |
19235343 |
tgggaagagagcatctgttctctgaataagcttagcactgggcaacacctaacaaactatattactgcttgcgactggctatcttataaaccttgtcgct |
19235244 |
T |
|
| Q |
202 |
ttactgataataactacagttggacagaagtcatgtaaagagaaagacatgtggattctgtagt |
265 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||| ||||| || |||||||||||| |
|
|
| T |
19235243 |
tcactgataataactacagttggacagaagtcatgtaaagag-aagacctgcggattctgtagt |
19235181 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 16 - 74
Target Start/End: Complemental strand, 19235397 - 19235339
Alignment:
| Q |
16 |
gagatgaatcatttgtgtcatgggttctgttatatttggatctgaagaagatagtggga |
74 |
Q |
| |
|
|||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19235397 |
gagatggatcatttgtgtgatgggttctgttatatttggatctgaagaagatagtggga |
19235339 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University