View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10580_low_19 (Length: 265)
Name: NF10580_low_19
Description: NF10580
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10580_low_19 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 67 - 250
Target Start/End: Complemental strand, 32856328 - 32856145
Alignment:
| Q |
67 |
aatgacaaaggttagtaattagttgttaaatttagatctatttctttgtccacgttcgaacccagaacccccaactctttctctcttaactcaaagcaag |
166 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32856328 |
aatgacaaaggttagtaattagttgttaaatttagatctatttctctgtccacgttcgaacccagaacccccaactctttctctcttaactcaaagcaag |
32856229 |
T |
|
| Q |
167 |
agctatccaaccctctctcatccgtggtttctaatttggggaaaatgttagattagaaatagattaaaaagtgtatctgtttct |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32856228 |
agctatccaaccctctctcatccgtggtttctaatttggggaaaatgttagattagaaatagattaaaaagtgtatctgtttct |
32856145 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 66 - 98
Target Start/End: Original strand, 10223394 - 10223426
Alignment:
| Q |
66 |
taatgacaaaggttagtaattagttgttaaatt |
98 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
10223394 |
taatgacaaatgttagtaattagttgttaaatt |
10223426 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University