View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10580_low_23 (Length: 250)
Name: NF10580_low_23
Description: NF10580
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10580_low_23 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 39 - 240
Target Start/End: Original strand, 9959625 - 9959820
Alignment:
| Q |
39 |
ttatgtctatagtaagttgttggaaatcagtagttttgaagcataccttatcatgtaaatacatgccattccccaccttaagtttcatttttattttgat |
138 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
9959625 |
ttatgtctatagtaagttgttggaaatcactagttttgaagcataccttattatgtaaatacatgccattccccactttaagtttcatttttattttgat |
9959724 |
T |
 |
| Q |
139 |
gaaagcaccaaaatataaaagacagcaccttaaatttcatttaataacaaagaaaaacaatcttattttcgatggcttagttctgtaataacgatgccta |
238 |
Q |
| |
|
|||||||| | |||||||| |||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
9959725 |
gaaagcacta------aaaagacaacaccttaagtttcatttaataacaaagaaaaacaatcttattttcgaaggcttagttctgtaataacgatgccta |
9959818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University