View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10580_low_28 (Length: 245)
Name: NF10580_low_28
Description: NF10580
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10580_low_28 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 106; Significance: 4e-53; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 16 - 133
Target Start/End: Complemental strand, 25639057 - 25638941
Alignment:
| Q |
16 |
catatctcgacaccatcgtccacctcacatgatactacaagttcataaattattctgtctcaatctcataattgttagttcaaatcttgtcctttaatgg |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
25639057 |
catatctcgacaccatcgtccacctcacatgatactacaagttcataaattattctgtcacaatctcataattgtt-gttcaaatcttgtcctttaatgg |
25638959 |
T |
|
| Q |
116 |
tagcatctgggtcgataa |
133 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
25638958 |
tagcatctgggtcgataa |
25638941 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University