View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10580_low_30 (Length: 241)
Name: NF10580_low_30
Description: NF10580
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10580_low_30 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 74; Significance: 5e-34; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 145 - 222
Target Start/End: Complemental strand, 8041753 - 8041676
Alignment:
| Q |
145 |
attcggaaatcctctgtttgagaatgaacgaatctgacacataaattctacgatgagaagttctatgggaggttctgg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8041753 |
attcggaaatcctctgtttgagaatgaacgaatctcacacataaattctacgatgagaagttctatgggaggttctgg |
8041676 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 50; Significance: 9e-20; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 149 - 222
Target Start/End: Original strand, 42527332 - 42527405
Alignment:
| Q |
149 |
ggaaatcctctgtttgagaatgaacgaatctgacacataaattctacgatgagaagttctatgggaggttctgg |
222 |
Q |
| |
|
|||||||| |||||||||||||||| ||||| |||||||||||||| ||||||||||||| ||||||| ||||| |
|
|
| T |
42527332 |
ggaaatccactgtttgagaatgaacaaatctcacacataaattctatgatgagaagttctctgggagggtctgg |
42527405 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University