View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10580_low_40 (Length: 222)
Name: NF10580_low_40
Description: NF10580
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10580_low_40 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 207
Target Start/End: Complemental strand, 4294602 - 4294396
Alignment:
| Q |
1 |
gctttagagtgcagtggatcaacaagaatgagtggtcctcttgtcggagacggcgagaagaacaatcgacgccggagaacggaggtgatgctgctgattc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4294602 |
gctttagagtgcagtggatcaacaagaatgagtggtcctcttgtcggagacggcgagaagaccaatcgacgccggagaacggaggtgatgctgctgattc |
4294503 |
T |
|
| Q |
101 |
ttcgaggtttatgcatgggaagttctgttgtttctttgtcactaatgatcacagctaaacaaagcagttctgtttctatctatggttttcacttaccagt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4294502 |
ttcgaggtttatgcatgggaagttctgttgtttctttgtcactaatgatcacagctaaacaaagcagttctgtttctatctatggttttcacttaccagt |
4294403 |
T |
|
| Q |
201 |
tcattct |
207 |
Q |
| |
|
||||||| |
|
|
| T |
4294402 |
tcattct |
4294396 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University