View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10580_low_43 (Length: 209)
Name: NF10580_low_43
Description: NF10580
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10580_low_43 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 114; Significance: 5e-58; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 114; E-Value: 5e-58
Query Start/End: Original strand, 19 - 194
Target Start/End: Complemental strand, 24045836 - 24045660
Alignment:
| Q |
19 |
tgtgatactattggtcccacttatcttcttcatatcattttgc-tttgtgattgtggattccaatggttctgttttgccacggtggannnnnnnnnnnnn |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24045836 |
tgtgatactattggtcccacttatcttcttcatatcattttgcttttgtgattgtggattccaatggttctgttttgccacggtggattttttgtctgtt |
24045737 |
T |
|
| Q |
118 |
nnnncttgaatgaaaaggtagtcttaacaattttaaaactaatttatgcctttttaagtattattgcgtaggtcctt |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
24045736 |
ttttcttgaatgaaaaggtagtcttaacaattttaaaactaatttatgcctttttaagtattattgtgtaggtcctt |
24045660 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University