View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10580_low_9 (Length: 358)
Name: NF10580_low_9
Description: NF10580
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10580_low_9 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 123; Significance: 4e-63; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 123; E-Value: 4e-63
Query Start/End: Original strand, 199 - 333
Target Start/End: Complemental strand, 10361382 - 10361249
Alignment:
| Q |
199 |
ctggctatcctattcgtttgatgataattgacaagtctgtgaaaacacaattctgacattacgtattgcatacatttggtttttgagtaaaatttggcaa |
298 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10361382 |
ctggctatcctattcgtttgatgataattgacaagtatgtgaaaacacaattctgacattacgtattgcatacatttggtttttgagtaaaatttggcaa |
10361283 |
T |
|
| Q |
299 |
tccaataatgaatagtttgaacgctcgtttgctct |
333 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| |
|
|
| T |
10361282 |
tccaataatgaatag-ttgaacgctcgtttgctct |
10361249 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 98; E-Value: 3e-48
Query Start/End: Original strand, 18 - 143
Target Start/End: Complemental strand, 10361566 - 10361441
Alignment:
| Q |
18 |
actggtatgagctctcttgtctggttttacttgattttggtttacttgtgactgagaagcaagttttattatgtattatcgaataaaccagctaggttcc |
117 |
Q |
| |
|
||||| |||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
10361566 |
actggcatgagctctcttgtctggttttgattgattttggtttacttgtgactgggaagcaagttttattatgtattaacgaataaaccagctaggttcc |
10361467 |
T |
|
| Q |
118 |
cctttatggagttaaaaggtaatgag |
143 |
Q |
| |
|
||||| ||||||||||||||||||| |
|
|
| T |
10361466 |
ccttttaggagttaaaaggtaatgag |
10361441 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University