View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10581_high_6 (Length: 251)
Name: NF10581_high_6
Description: NF10581
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10581_high_6 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 113; Significance: 3e-57; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 122 - 242
Target Start/End: Original strand, 30782519 - 30782639
Alignment:
| Q |
122 |
gctctctactagcgagttatgtccagatttgtggtagagagtccttatacctgcaacaaaacgtgtcttgttatttattgcaataatggttttgatgctc |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
30782519 |
gctctctactagcgagttatgtccagatttgtggtagagagtccttatacctgcaacaaaacgtgtcttgttatttattgcaataatggtttttatgctc |
30782618 |
T |
|
| Q |
222 |
tctattagcgagtgatgtcca |
242 |
Q |
| |
|
||||||||||||| ||||||| |
|
|
| T |
30782619 |
tctattagcgagttatgtcca |
30782639 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 189 - 242
Target Start/End: Original strand, 30245591 - 30245642
Alignment:
| Q |
189 |
ttgttatttattgcaataatggttttgatgctctctattagcgagtgatgtcca |
242 |
Q |
| |
|
||||| |||||||||| |||||||||||||||||||||||||||| ||||||| |
|
|
| T |
30245591 |
ttgttgtttattgcaa--atggttttgatgctctctattagcgagttatgtcca |
30245642 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 19 - 52
Target Start/End: Original strand, 30782416 - 30782449
Alignment:
| Q |
19 |
atgatgatttcagttcaaacccctgcgaaagtaa |
52 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
30782416 |
atgatgatttcagttcaaacccctgcgaaagtaa |
30782449 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University