View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10581_low_14 (Length: 286)
Name: NF10581_low_14
Description: NF10581
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10581_low_14 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 16 - 270
Target Start/End: Original strand, 14003624 - 14003878
Alignment:
| Q |
16 |
agcagagaaaacccaccaagacatttcaaatctaacaatttaattttaactaactttgtagtttcattcggacatggccaattgtcaaagagaacagagg |
115 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
14003624 |
agcacagaaaacccaccaagacatttcaaatctaacaatttaattttaactaactttgtagtttcattcggacatggtcaattgtcaaagagaacagagg |
14003723 |
T |
|
| Q |
116 |
gtccatatgcttcaattttaatctcatattgttacaaatcatttctttaacttgtgtaggttcaatttgactgtaagtgatcgtagatgtggagaaaatg |
215 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14003724 |
gtccatatgcttcaattttattctcatattgttacaaatcatttctttaacttgtgtaggttcaatttgactgtaagtgatcgtagatgtggagaaaatg |
14003823 |
T |
|
| Q |
216 |
ctgaagttggcgtcaaccactattaacattgtatgcaaaacgcacttctaagagg |
270 |
Q |
| |
|
||||||||||||||| |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
14003824 |
ctgaagttggcgtcagccaccattaacattgtatgcaaaacgcacttctaagagg |
14003878 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University