View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10581_low_16 (Length: 274)
Name: NF10581_low_16
Description: NF10581
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10581_low_16 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 237; Significance: 1e-131; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 19 - 270
Target Start/End: Complemental strand, 13878532 - 13878280
Alignment:
| Q |
19 |
agttagattgcctgcaaagtcacttatgcgttttaaatgtgttcaacgatcttggaacattcttttcaagaaccctaaatttgttattaggaacatgcat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13878532 |
agttagattgcctgcaaagtcacttatgcgttttaaatgtgttcaaagatcttggaacattcttttcaagaaccctaaatttgttattaggaacatgcat |
13878433 |
T |
|
| Q |
119 |
atccatatgtctaatgatgatgatgaccaccatcgtttcgtgatcattaaacagtatacaaaagaaacatgccctaaaacccataaccacaatgacagga |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13878432 |
atccatatgtctaatgatgatgatgaccaccatcgtttcgttatcattaaacagtatacaaaagaaacatgccctaaaacccataaccacaatgacagga |
13878333 |
T |
|
| Q |
219 |
tctttgacaagcccattgaatcaacttgcctagaaacccacct-atgcttctc |
270 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
13878332 |
tctttgacaagcccattgaatcaacttgcctagaaacccacctaatgcttctc |
13878280 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 19 - 56
Target Start/End: Original strand, 19071430 - 19071467
Alignment:
| Q |
19 |
agttagattgcctgcaaagtcacttatgcgttttaaat |
56 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
19071430 |
agttagatttcctgcaaagtcacttatgcgttttaaat |
19071467 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 19 - 56
Target Start/End: Original strand, 19119320 - 19119357
Alignment:
| Q |
19 |
agttagattgcctgcaaagtcacttatgcgttttaaat |
56 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
19119320 |
agttagatttcctgcaaagtcacttatgcgttttaaat |
19119357 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 38 - 87
Target Start/End: Original strand, 34169207 - 34169256
Alignment:
| Q |
38 |
tcacttatgcgttttaaatgtgttcaacgatcttggaacattcttttcaa |
87 |
Q |
| |
|
||||| |||||||| ||||| ||||||||||||||||||||||| ||||| |
|
|
| T |
34169207 |
tcactaatgcgtttcaaatgcgttcaacgatcttggaacattctattcaa |
34169256 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University