View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10581_low_19 (Length: 251)

Name: NF10581_low_19
Description: NF10581
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10581_low_19
NF10581_low_19
[»] chr2 (3 HSPs)
chr2 (122-242)||(30782519-30782639)
chr2 (189-242)||(30245591-30245642)
chr2 (19-52)||(30782416-30782449)


Alignment Details
Target: chr2 (Bit Score: 113; Significance: 3e-57; HSPs: 3)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 122 - 242
Target Start/End: Original strand, 30782519 - 30782639
Alignment:
122 gctctctactagcgagttatgtccagatttgtggtagagagtccttatacctgcaacaaaacgtgtcttgttatttattgcaataatggttttgatgctc 221  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
30782519 gctctctactagcgagttatgtccagatttgtggtagagagtccttatacctgcaacaaaacgtgtcttgttatttattgcaataatggtttttatgctc 30782618  T
222 tctattagcgagtgatgtcca 242  Q
    ||||||||||||| |||||||    
30782619 tctattagcgagttatgtcca 30782639  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 189 - 242
Target Start/End: Original strand, 30245591 - 30245642
Alignment:
189 ttgttatttattgcaataatggttttgatgctctctattagcgagtgatgtcca 242  Q
    ||||| ||||||||||  |||||||||||||||||||||||||||| |||||||    
30245591 ttgttgtttattgcaa--atggttttgatgctctctattagcgagttatgtcca 30245642  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 19 - 52
Target Start/End: Original strand, 30782416 - 30782449
Alignment:
19 atgatgatttcagttcaaacccctgcgaaagtaa 52  Q
    ||||||||||||||||||||||||||||||||||    
30782416 atgatgatttcagttcaaacccctgcgaaagtaa 30782449  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University