View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10581_low_21 (Length: 249)
Name: NF10581_low_21
Description: NF10581
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10581_low_21 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 5 - 232
Target Start/End: Complemental strand, 6351316 - 6351089
Alignment:
| Q |
5 |
atgaaatggtcatgcaggttcttaactgatatgattgacaaataacagcattgttatgcatatgacacttgttgtataattgcatttcttattgccatca |
104 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
6351316 |
atgaaatggtcatgcaggttcttaactgaaatgattgacaaataacagcattgttatgcatatgacacttgtggtataattgcatttcttattgccatca |
6351217 |
T |
|
| Q |
105 |
agaacgaaaagaactaacgagaaagagataaattgaaattcggagtattttattttttatgaataagagattcggagtattgttgaatctggtatctatc |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6351216 |
agaacgaaaagaactaacgagaaagagataaattgaaattcggagtattttattttttatgaataagagattcggagtattgttgaatctggtatctatc |
6351117 |
T |
|
| Q |
205 |
accatgggtgaaggtaggtcatttaaat |
232 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
6351116 |
accatgggtgaaggtaggtcatttaaat |
6351089 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University