View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10581_low_25 (Length: 242)

Name: NF10581_low_25
Description: NF10581
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10581_low_25
NF10581_low_25
[»] chr4 (1 HSPs)
chr4 (1-223)||(21839887-21840109)
[»] chr1 (2 HSPs)
chr1 (33-104)||(40443294-40443365)
chr1 (25-104)||(40440271-40440350)


Alignment Details
Target: chr4 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 21840109 - 21839887
Alignment:
1 ttagctgaaggtgacaagaatgagatgtgaattccatgagagaataacttgttggataattgcacaaatggactaatgtgaccgaatgcaaggaagggaa 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||    
21840109 ttagctgaaggtgacaagaatgagatgtgaattccatgagagaataacttgttggataattgcacaaatggactaatgtgaccaaatgctaggaagggaa 21840010  T
101 acataactacatgaatctcactgttgattatcctttcaccactcatctttgcctaatttattatcactttgtgttgtttctaagaatggactaacaagaa 200  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || || |  |    
21840009 acatagctacatgaatctcactgttgattatcctttcaccactcatctttgcctaatttattatcactttgtgttgtttctaagaatggtcttaccaaga 21839910  T
201 tggtggccaaggatgctcttata 223  Q
    |||||||||| | | ||||||||    
21839909 tggtggccaacggttctcttata 21839887  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 44; Significance: 4e-16; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 33 - 104
Target Start/End: Complemental strand, 40443365 - 40443294
Alignment:
33 tccatgagagaataacttgttggataattgcacaaatggactaatgtgaccgaatgcaaggaagggaaacat 104  Q
    ||||||||||||||| ||||| |||||||| ||||| |||||||||||||| ||| ||||||| ||||||||    
40443365 tccatgagagaataatttgtttgataattgaacaaaaggactaatgtgaccaaatacaaggaatggaaacat 40443294  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 25 - 104
Target Start/End: Complemental strand, 40440350 - 40440271
Alignment:
25 atgtgaattccatgagagaataacttgttggataattgcacaaatggactaatgtgaccgaatgcaaggaagggaaacat 104  Q
    ||||||| ||| ||||| |||| ||||||||||||||| ||||| ||||| || ||||| ||||||||||| ||||||||    
40440350 atgtgaactccttgagaaaatagcttgttggataattgaacaaaaggacttatatgaccaaatgcaaggaatggaaacat 40440271  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University