View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10581_low_27 (Length: 240)
Name: NF10581_low_27
Description: NF10581
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10581_low_27 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 224; Significance: 1e-123; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 1 - 236
Target Start/End: Original strand, 38322612 - 38322847
Alignment:
| Q |
1 |
actcctgtcattgaagagtatacaattacaaggtttgttcaacatggcttatgtactagaaattgaaacagttcatagatttttggttgtagttgtaacc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38322612 |
actcctgtcattgaagagtatacaattacaaggtttgttcaacatggcttatgtactagaaattgaaacagttcatagatttttggttgtagttgtaacc |
38322711 |
T |
|
| Q |
101 |
caaaaggttaatgattttaactacatctagtggttttggcttctctgaaggtaagagcttcaggtatagttcttataccttgtttcacttgctgctgatg |
200 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38322712 |
caaaaggttaatgattctaactacatctagtggttttggcttctctgaaggtaagagcttcaggtatagttcttataccttgtttcacttgctgctgatg |
38322811 |
T |
|
| Q |
201 |
gtcgttgcttcttagcatcaatacttcatctctctc |
236 |
Q |
| |
|
| ||||||||||||||||||||||||||| |||||| |
|
|
| T |
38322812 |
gccgttgcttcttagcatcaatacttcatgtctctc |
38322847 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 20 - 89
Target Start/End: Original strand, 38318495 - 38318568
Alignment:
| Q |
20 |
atacaattacaaggtttgttcaacatggctt----atgtactagaaattgaaacagttcatagatttttggttg |
89 |
Q |
| |
|
|||||||||||||||||||||||||| || | ||||| |||||||||||||||| || ||||||||||||| |
|
|
| T |
38318495 |
atacaattacaaggtttgttcaacatagcctatgcatgtattagaaattgaaacagtacaaagatttttggttg |
38318568 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 20 - 69
Target Start/End: Complemental strand, 38848609 - 38848560
Alignment:
| Q |
20 |
atacaattacaaggtttgttcaacatggcttatgtactagaaattgaaac |
69 |
Q |
| |
|
||||||||| |||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
38848609 |
atacaattaaaaggtttgttcaacatagtctatgtactagaaattgaaac |
38848560 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University