View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10581_low_29 (Length: 240)
Name: NF10581_low_29
Description: NF10581
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10581_low_29 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 120; Significance: 2e-61; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 12 - 161
Target Start/End: Complemental strand, 9866294 - 9866149
Alignment:
| Q |
12 |
agaagaacatatacatttatagcaaaataataatgataattatgtgaaaaatattgtaggtttaatataatttttataaccaaccgacatcagtcttaac |
111 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
9866294 |
agaagaacatatacatttatagcaaaatgataatgatatttatgtgaaaaatattgtaggtttaatataattttt-taaccaaccgacatcagtcttaac |
9866196 |
T |
|
| Q |
112 |
aagcatgagtaataataatgtaccaaaaaagcatgagtaatacttggctt |
161 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9866195 |
aagcatgag---taataatgtaccaaaaaagcatgagtaatacttggctt |
9866149 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 182 - 222
Target Start/End: Complemental strand, 9866135 - 9866095
Alignment:
| Q |
182 |
catggtatggcatcacctcgtgaaattgttcaaataggtag |
222 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
9866135 |
catggtatggcgtcacctcgtgaaattgttcaaataggtag |
9866095 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University