View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10581_low_33 (Length: 236)
Name: NF10581_low_33
Description: NF10581
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10581_low_33 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 25 - 236
Target Start/End: Original strand, 39718449 - 39718660
Alignment:
| Q |
25 |
ggaatatactaagagaccaatgagaaagaatatgagagctacttggttatgtgttggttgggtcagtggtgggaagagaatgagaatcccactaaattag |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39718449 |
ggaatatactaagagaccaatgagaaagaatatgagagctacttggttatgtgttggttgtgtcagtggtgggaagagaatgagaatcccactaaattag |
39718548 |
T |
 |
| Q |
125 |
gatttcactttgttgatactaataggcttcttcatcacccttttatttctctctcttgatgaatactatttatttcaatctatagttagagactaattcc |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39718549 |
gatttcactttgttgatactaataggcttcttcatcacccttttatccctctctcttgatgaatactatttatttcaatctatagttagagactaattcc |
39718648 |
T |
 |
| Q |
225 |
ttcaaatacttc |
236 |
Q |
| |
|
|||||||||||| |
|
|
| T |
39718649 |
ttcaaatacttc |
39718660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University