View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10582_high_10 (Length: 242)
Name: NF10582_high_10
Description: NF10582
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10582_high_10 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 164; Significance: 9e-88; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 12 - 218
Target Start/End: Complemental strand, 27243179 - 27242972
Alignment:
| Q |
12 |
aattgcgtatgacaattgaattaagaacggtgattgcgtatgataattgaattaagaacggagatagtgtcaagtggacactgtttacatgttgttttat |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27243179 |
aattgcgtatgacaattgaattaagaacggagattgcgtatgataattgaattaagaatggagatagtgtcaagtggacactgtttacatgttgttttat |
27243080 |
T |
|
| Q |
112 |
gagaagctttaaacaaac-nnnnnnnncacgtggtttttatatgttcgtatttggaccgctagggtgacctattttgaggacaaatcattagaccacttc |
210 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27243079 |
gagaagctttaaacaaactttttttttcacgtggtttttatatgttcgtatttggacggctagggtgacctattttgaggacaaatcattagaccacttc |
27242980 |
T |
|
| Q |
211 |
tttttcaa |
218 |
Q |
| |
|
|||||||| |
|
|
| T |
27242979 |
tttttcaa |
27242972 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University