View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10582_high_12 (Length: 240)
Name: NF10582_high_12
Description: NF10582
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10582_high_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 227
Target Start/End: Original strand, 41980725 - 41980951
Alignment:
| Q |
1 |
attgatgatttcctccggtttcatttcttcttataagnnnnnnnagcgactttttagtaagttattatgaatgggaattgggagcaattggattctgtag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41980725 |
attgatgatttcctccggtttcatttcttcttataagtttttttagcgactttttagtaagttattatgaatgggaattgggagcaattggattctgtag |
41980824 |
T |
 |
| Q |
101 |
aattttgggatattgtcctacatatcatgatattattgccatcttatgtcttgttctaatgggttaaatatatttattttggattgaatgggttggatta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
41980825 |
aattttgggatattgtcctacatatcatgatattattgccatcttatgccttgttctaatgggttaaatatatttattttggattgaatggattggatta |
41980924 |
T |
 |
| Q |
201 |
taccagttgttctaatggctgttctct |
227 |
Q |
| |
|
|||||||||||||||||| |||||||| |
|
|
| T |
41980925 |
taccagttgttctaatggttgttctct |
41980951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University