View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10582_high_6 (Length: 292)
Name: NF10582_high_6
Description: NF10582
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10582_high_6 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 110; Significance: 2e-55; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 173 - 282
Target Start/End: Complemental strand, 34946622 - 34946513
Alignment:
| Q |
173 |
ggttattgtgaggatgaaaccagtgcgcagtgaaaatgacgaagcagattccattgttaagaaagtttccagcaattctttatcaatcaacggtcaggat |
272 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34946622 |
ggttattgtgaggatgaaaccagtgcgcagtgaaaatgacgaagcagattccattgttaagaaagtttccagcaattctttatcaatcaacggtcaggat |
34946523 |
T |
 |
| Q |
273 |
ttcacctttg |
282 |
Q |
| |
|
|||||||||| |
|
|
| T |
34946522 |
ttcacctttg |
34946513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 18 - 128
Target Start/End: Complemental strand, 34946777 - 34946667
Alignment:
| Q |
18 |
cataaccctctcaaacgcaagctcgatgatactctcactacctcctccgattccggcgtcaaggtgggttttctttctcattccactcttttcctcatcc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34946777 |
cataaccctctcaaacgcaagctcgatgatactctcactacctcctccgattccggcgtcaaggtgggttttctttctcattccactcttttcctcatcc |
34946678 |
T |
 |
| Q |
118 |
accatcaccga |
128 |
Q |
| |
|
||||| ||||| |
|
|
| T |
34946677 |
accattaccga |
34946667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University