View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10582_high_8 (Length: 251)

Name: NF10582_high_8
Description: NF10582
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10582_high_8
NF10582_high_8
[»] chr8 (4 HSPs)
chr8 (17-241)||(6240892-6241116)
chr8 (42-209)||(6249328-6249495)
chr8 (18-110)||(6226673-6226765)
chr8 (19-205)||(6233830-6234016)
[»] chr1 (1 HSPs)
chr1 (26-210)||(17545359-17545549)


Alignment Details
Target: chr8 (Bit Score: 213; Significance: 1e-117; HSPs: 4)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 17 - 241
Target Start/End: Complemental strand, 6241116 - 6240892
Alignment:
17 actaaattcatcactcattgcattgtttttgtgaataccgagcgcaaagtggactggctcatggacaaaatgcgaagcagatattatacagtgtcgacca 116  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
6241116 actaaattcatcactcattgcattgtttttgtgaataccgagcgcaaagtggactggctcatggacaaaatgcgaagcagatattatacagtgttgacca 6241017  T
117 ttcatgatgacatggaccagaacactagggatatcatcgtacgcgatttccagtctggttctcctcagattctcattaccaccgaccccttggtctacgg 216  Q
    |||||||||||||||||||||||||||||||||||||||||||  |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6241016 ttcatgatgacatggaccagaacactagggatatcatcgtacgtaatttccagtctggttctcctcagattctcattaccaccgaccccttggtctacgg 6240917  T
217 tttagatgtgcaggaagtgtctctg 241  Q
    |||||||||||||||||||||||||    
6240916 tttagatgtgcaggaagtgtctctg 6240892  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 42 - 209
Target Start/End: Complemental strand, 6249495 - 6249328
Alignment:
42 tttttgtgaataccgagcgcaaagtggactggctcatggacaaaatgcgaagcagatattatacagtgtcgaccattcatgatgacatggaccagaacac 141  Q
    ||||||||||||||  ||| |||||||||||||| | ||| || |||||||||||| || ||||||| ||  ||| ||||| ||||||||||||||||||    
6249495 tttttgtgaataccaggcggaaagtggactggcttacggataagatgcgaagcagagatcatacagtctcagccactcatggtgacatggaccagaacac 6249396  T
142 tagggatatcatcgtacgcgatttccagtctggttctcctcagattctcattaccaccgaccccttgg 209  Q
    ||||||||||||| | || || || | |||||| ||| |||   ||||||| |||||||||| |||||    
6249395 tagggatatcatcatgcgtgagtttcggtctggctcttctcgagttctcataaccaccgacctcttgg 6249328  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 18 - 110
Target Start/End: Complemental strand, 6226765 - 6226673
Alignment:
18 ctaaattcatcactcattgcattgtttttgtgaataccgagcgcaaagtggactggctcatggacaaaatgcgaagcagatattatacagtgt 110  Q
    |||||| |||||||||||| || || ||||||||||||  |  |||||||||||||||||||||| |  ||||||||||| || ||| |||||    
6226765 ctaaatccatcactcattgtatcgtctttgtgaataccatggacaaagtggactggctcatggacgagttgcgaagcagagatcataaagtgt 6226673  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 19 - 205
Target Start/End: Complemental strand, 6234016 - 6233830
Alignment:
19 taaattcatcactcattgcattgtttttgtgaataccgagcg-caaagtggactggctcatggacaaaatgcgaagcagatattatacagtgtcgaccat 117  Q
    ||||| |||||||||||| || || |||||||||||  | || ||||||||||||||||| |||||| |||||||||||| || ||   ||      |||    
6234016 taaatccatcactcattgtatcgtctttgtgaatact-atcgacaaagtggactggctcacggacaagatgcgaagcagagatcattatgt------cat 6233924  T
118 tcatgatgacatggaccagaacactagggatatcatcgtacgcga------tttccagtctggttctcctcagattctcattaccaccgacccc 205  Q
    ||||| ||||| |||||||||||||| ||||| ||| | ||| ||      |||| ||||||| ||||||||  ||||||||||||||||||||    
6233923 tcatggtgacagggaccagaacactatggataccattgaacgtgagtttcttttcgagtctggctctcctcaagttctcattaccaccgacccc 6233830  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 60; Significance: 1e-25; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 26 - 210
Target Start/End: Original strand, 17545359 - 17545549
Alignment:
26 atcactcattgcattgtttttgtgaataccgagcgcaaagtggactggctcatggacaaaatgcgaagcagatattatacagtgtcgaccattcatgatg 125  Q
    ||||||||||| ||||| |||||| |||||  | |||||||||| ||||||| |||||| |||| ||||||| || ||| ||||||   ||| ||   ||    
17545359 atcactcattgtattgtctttgtggataccaggtgcaaagtggattggctcacggacaagatgcaaagcagagatcataaagtgtcagtcatccagagtg 17545458  T
126 acatggaccagaacactagggatatcatcgtacgcga------tttccagtctggttctcctcagattctcattaccaccgaccccttggt 210  Q
    |||||||||||||||||||||||||||| || |||||      || ||||||||| ||||||||  ||||||||||||| |||||||||||    
17545459 acatggaccagaacactagggatatcattgtgcgcgagttcttttcccagtctggctctcctcatgttctcattaccacagaccccttggt 17545549  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University