View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10582_low_16 (Length: 272)
Name: NF10582_low_16
Description: NF10582
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10582_low_16 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 266; Significance: 1e-148; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 266; E-Value: 1e-148
Query Start/End: Original strand, 6 - 271
Target Start/End: Complemental strand, 7666815 - 7666550
Alignment:
| Q |
6 |
aaaataacgcatccccaacttttgattctttctcacagccactgagttttgtctatatggttgcaatttaaccaacacttggtcgcctatctcaagtgac |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7666815 |
aaaataacgcatccccaacttttgattctttctcacagccactgagttttgtctatatggttgcaatttaaccaacacttggtcgcctatctcaagtgac |
7666716 |
T |
|
| Q |
106 |
acatctgtttgttttctatcagcttgtgttttcatagtttgttgtgccttctgcagattagctttcaactgttgaagtaactgatctctctctatcagtt |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7666715 |
acatctgtttgttttctatcagcttgtgttttcatagtttgttgtgccttctgcagattagctttcaactgttgaagtaactgatctctctctatcagtt |
7666616 |
T |
|
| Q |
206 |
gtaattgcagatcaggagtatctccataattaggaacatatcgaatcaactttggaggatctctgc |
271 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7666615 |
gtaattgcagatcaggagtatctccataattaggaacatatcgaatcaactttggaggatctctgc |
7666550 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University