View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10582_low_23 (Length: 226)
Name: NF10582_low_23
Description: NF10582
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10582_low_23 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 9 - 225
Target Start/End: Original strand, 27243213 - 27243426
Alignment:
| Q |
9 |
taacatatgttatatattcttgaacaaaaaagcatatgttatatctacatgctcattggcaaattgttcaaatggtagtaccaaatattcacgttttgat |
108 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||||||||||||| | ||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
27243213 |
taacatatgtcatatattcttcaacaaaaaagcatatgttataacaacatgctcattggcaaattgttcaaatggtagtcccaaatattcacgttttgat |
27243312 |
T |
 |
| Q |
109 |
ggaaaacacaatcttcactcaaaagtcaacttgcttaaccgtagggatatttggtactagatatcaagcttcaaagatcaataattctaatcatcatctt |
208 |
Q |
| |
|
|| ||||||||| ||||||||||||||||||||||||||| | ||||||||||| ||||||||||||||||||| | ||||||| |||||| |||| |
|
|
| T |
27243313 |
ggcaaacacaatgttcactcaaaagtcaacttgcttaacctttgggatatttgg---tagatatcaagcttcaaaggttgataattccaatcattatctg |
27243409 |
T |
 |
| Q |
209 |
agactccattccaaaat |
225 |
Q |
| |
|
||| || |||||||||| |
|
|
| T |
27243410 |
agattcaattccaaaat |
27243426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University