View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10582_low_5 (Length: 366)
Name: NF10582_low_5
Description: NF10582
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10582_low_5 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 253; Significance: 1e-140; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 253; E-Value: 1e-140
Query Start/End: Original strand, 19 - 310
Target Start/End: Original strand, 30870027 - 30870319
Alignment:
| Q |
19 |
taaagatgaattgtgatcccc-agaattgttatcctcgtgccatgtgtcatgcacgaactagaaacgtgtgaaggaaatgcttcatcttcatgcaccatc |
117 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30870027 |
taaagatgaattgtgatcccccagaattgttatcctcgtgccgtgtgtcatgcacgaactagaaacgtgtgaaggaaatgcttcatcttcatgcaccatc |
30870126 |
T |
|
| Q |
118 |
tactaacgagttgtgtaagcgtggccaagtgtggtatgtatggacccttacaaccagttgtgtgagagtaatcccaatgtataacttaatgggtttggtt |
217 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30870127 |
tactaacgagttgtgtaagcgtggacaagtgtggtacgcatggacccttacaaccagttgtgtgagagtaatcccaatgtataacttaatgggtttggtt |
30870226 |
T |
|
| Q |
218 |
gacaaaagaaatatccattaggttaagaggttaatgctattaaacgatacacttcgaaggattagagggcactcttgacctaaagaatgtatt |
310 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||| ||| |||| |
|
|
| T |
30870227 |
gacaaaagaaatatccattaggttaagaggttaattctattaaacgatacacttcgaaggattagagggcattcttgacctaaacaatctatt |
30870319 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University