View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10583_14 (Length: 371)
Name: NF10583_14
Description: NF10583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10583_14 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 264; Significance: 1e-147; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 1 - 352
Target Start/End: Original strand, 51114233 - 51114586
Alignment:
| Q |
1 |
catatatgtatttagttacggatataacttatttatcccttttattatattatacgctagactagatgtttttattnnnnnnnnnnnnnn--atggtctt |
98 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||| |
|
|
| T |
51114233 |
catatatgtatttagttacggatttaacttatttatcccttttattatattatatgctagactagatgtttttatttgtgtgtgtgtgagtgatggtctt |
51114332 |
T |
|
| Q |
99 |
ctttggttggaattggaaaggtaacaatttagttaagcattcaagctcggtttttattttgattcaacttgcaagctgtaaattttggctatggtttggt |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51114333 |
ctttggttggaattggaaaggtaacaatttagttaagcattcaagctcggtttttattttgattcaacttgcaagctgtaaattttggctatggtttggt |
51114432 |
T |
|
| Q |
199 |
gttaatattattctagtacaaatttaattcttgattatctctttcnnnnnnnagatatctgagaaaatattctgctaattattcatgtccattggtgttt |
298 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
51114433 |
gttaatattattctagtacaaatttaattcttgattatctctttctttttttagatatctgagaaaatattctgcaaattattcatgtccattggtgttt |
51114532 |
T |
|
| Q |
299 |
gaaccttatttatgtgttggattagaagttagatagaatgcatgcttgaaatgt |
352 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51114533 |
gaaccttatttatttgttggattagaagttagatagaatgcatgcttgaaatgt |
51114586 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 44; Significance: 6e-16; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 92 - 175
Target Start/End: Complemental strand, 546450 - 546367
Alignment:
| Q |
92 |
tggtcttctttggttggaattggaaaggtaacaatttagttaagcattcaagctcggtttttattttgattcaacttgcaagct |
175 |
Q |
| |
|
||||||||||| | |||||||||||| |||||||||||| |||| ||||||| | | ||||||||||||||||||||||||| |
|
|
| T |
546450 |
tggtcttctttagaaagaattggaaaggaaacaatttagtttagcagtcaagcttgatctttattttgattcaacttgcaagct |
546367 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 187 - 243
Target Start/End: Complemental strand, 552621 - 552568
Alignment:
| Q |
187 |
ctatggtttggtgttaatattattctagtacaaatttaattcttgattatctctttc |
243 |
Q |
| |
|
||||||||||||||||||||||||| | |||||||||||||||||| |||||||| |
|
|
| T |
552621 |
ctatggtttggtgttaatattattc---tgcaaatttaattcttgattgtctctttc |
552568 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 94 - 132
Target Start/End: Original strand, 1553995 - 1554033
Alignment:
| Q |
94 |
gtcttctttggttggaattggaaaggtaacaatttagtt |
132 |
Q |
| |
|
||||||||||||||||||||||||| | ||||||||||| |
|
|
| T |
1553995 |
gtcttctttggttggaattggaaagattacaatttagtt |
1554033 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University