View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10583_low_9 (Length: 244)
Name: NF10583_low_9
Description: NF10583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10583_low_9 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 28102684 - 28102462
Alignment:
| Q |
1 |
ttatatagctatatacttaattaaataatcagattgttgaactcaagtgattaataatcgtcaattaataatgaattgtttgagaggataaaagtttgat |
100 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28102684 |
ttatatagctatatacttagttaaataatcagattgttgaactcaagtgattaataatcgtcgattaataatgaattgtttgagaggataaaagtttgat |
28102585 |
T |
|
| Q |
101 |
tgaatttttagtgagacaataagattgatcaaactttatttttctcataagaatttgaag-nnnnnnnnngaaataaaataggtaactactatgaatatc |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| || |||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
28102584 |
tgaatttttagtgagacaataagattgatcaaac-----ttatctcataagaatttgaagaaaaaaaaaagaaataaaataggtaactactatgaatatc |
28102490 |
T |
|
| Q |
200 |
ttttannnnnnnatgcagtacaagtaac |
227 |
Q |
| |
|
||||| |||||||||||||||| |
|
|
| T |
28102489 |
ttttatttttttatgcagtacaagtaac |
28102462 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University