View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10585_low_16 (Length: 233)
Name: NF10585_low_16
Description: NF10585
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10585_low_16 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 149; Significance: 8e-79; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 14 - 217
Target Start/End: Complemental strand, 36276025 - 36275837
Alignment:
| Q |
14 |
catagggataatgtccatgtccttgcatatgaaccggatgaaccggtacattcccgggttgaaccgaaccctgaatataataaaccggaaccggttgtgc |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36276025 |
catagggataatgtccatgtccttgcatatgaaccgg---------tacattcccgggttgaaccgaaccctgaatataataaaccggaaccggttgtgc |
36275935 |
T |
 |
| Q |
114 |
atgatgaccagaataagcaccttcttgtggttgtggttgtggtcgtggttgaggttgttggtagtgaattgcagggttaatctgataattatccattttc |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36275934 |
atgatgaccagaataagcaccttcttgtggttg------tggtcgtggttgaggttgttggtagtgaattgcagggttaatctgataattatccattttc |
36275841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University