View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10585_low_6 (Length: 283)
Name: NF10585_low_6
Description: NF10585
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10585_low_6 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 173; Significance: 4e-93; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 84 - 268
Target Start/End: Original strand, 31454912 - 31455096
Alignment:
| Q |
84 |
aaaaacttggctgtaggtacgatggtacttacatgtgtctgcagctatattagctgtaactaaaattgtaacacaattttttggtcggttatgaagtaga |
183 |
Q |
| |
|
|||| ||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31454912 |
aaaaccttggctgtaggtacaatggtacttacatgtgtctgcagctatatcagctgtaactaaaattgtaacacaattttttggtcggttatgaagtaga |
31455011 |
T |
|
| Q |
184 |
tgcagatgcttagtttatgtatatttttgaggatgcttagtttatagttactgtaagaaaataaaatagattcacacattatttt |
268 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31455012 |
tgcagatgcttagtttatgtatatttttgaggatgcttagtttatagttactgtaagaaaataaaatagattcacacattatttt |
31455096 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 13 - 51
Target Start/End: Original strand, 31454827 - 31454865
Alignment:
| Q |
13 |
ggcaagatgatgaagaaaattaatatggattaaaaagta |
51 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
31454827 |
ggcaagatgatgaagataattaatatggattaaaaagta |
31454865 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University