View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10586_high_12 (Length: 217)
Name: NF10586_high_12
Description: NF10586
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10586_high_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 136; Significance: 4e-71; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 45 - 188
Target Start/End: Original strand, 3000308 - 3000451
Alignment:
| Q |
45 |
attgatgatccaataaagcaaacaacaagatattagagagttagaaagattaagagatactaataagatcaaaagactacaagattggaatttcttttga |
144 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3000308 |
attgatgatccaataaagcaaacaacaagatattagagagctagaaagattaagagatactaataagatcaaaagactacaagattggaatttcttttga |
3000407 |
T |
 |
| Q |
145 |
atgcttttacttttaattatttcatattatagatatttatcttt |
188 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
3000408 |
atgcttttacttttaattatttcagattatagatatttatcttt |
3000451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 71 - 168
Target Start/End: Original strand, 8417901 - 8418000
Alignment:
| Q |
71 |
aagatattagagag--ttagaaagattaagagatactaataagatcaaaagactacaagattggaatttcttttgaatgcttttacttttaattatttca |
168 |
Q |
| |
|
|||||||||||| | ||| ||||||||||||||| ||| ||||| || ||||||||| | || |||||| || |||| ||||||||||||||| ||||| |
|
|
| T |
8417901 |
aagatattagaggggattaaaaagattaagagatattaaaaagataaagagactacaaaaatgaaatttcgttcgaatacttttacttttaattttttca |
8418000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University