View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10586_low_17 (Length: 235)
Name: NF10586_low_17
Description: NF10586
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10586_low_17 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 30 - 220
Target Start/End: Original strand, 33927785 - 33927975
Alignment:
| Q |
30 |
acagcaaagacatgggataacaaatttccctcttacctactcctggggaacgagaaattaaaccataatcaatatcctaactagaactatcatcattact |
129 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||| |
|
|
| T |
33927785 |
acagcaaagacatgggataacaaatttccctcttacctactcctggggaacgagaaattaaaccacaatcaatatcctagctagaactatcatcattact |
33927884 |
T |
 |
| Q |
130 |
gtcagaatcactcgaaatctctcccaacggtaaatgtctataataacccatttcgaagacaacctgtttgtaactccaatccagatgtttt |
220 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33927885 |
gtcagaatcactcgaaatctctcccaatagtaaatgtctataataacccatttcgaagacaacctgtttgtaactccaatccagatgtttt |
33927975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University