View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10587_high_13 (Length: 226)
Name: NF10587_high_13
Description: NF10587
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10587_high_13 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 1 - 211
Target Start/End: Complemental strand, 45864469 - 45864259
Alignment:
| Q |
1 |
gttgaatataatacggttcttgtactaatcagccaaaacaatttcagccaatattgtgattttgcagattgatgtggacattcttcaggaggtggttaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45864469 |
gttgaatataatacggttcttgtactaatcagccaaaacaatttcagccaatattgtgattttgcagattgatgtggacattcttcaggaggtggttaat |
45864370 |
T |
 |
| Q |
101 |
aggggatttgacaagaatcaattgattgagtcccttagcaacagggtgcaaaatgaggtttgttccattcattttcacattacatacctgcctgccagat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45864369 |
aggggatttgacaagaatcaattgattgagtcccttagcaacagggtgcaaaatgaggtttgttccattcattttcacattacatacctgcctgccagat |
45864270 |
T |
 |
| Q |
201 |
tgcttcttatt |
211 |
Q |
| |
|
||||||||||| |
|
|
| T |
45864269 |
tgcttcttatt |
45864259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 67; Significance: 6e-30; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 42 - 211
Target Start/End: Complemental strand, 4051643 - 4051467
Alignment:
| Q |
42 |
tttcagccaatattgtgattttgcagattgatgtggacattcttcaggaggtggttaataggggatttgacaagaatcaattgattgagtcccttagcaa |
141 |
Q |
| |
|
||||| ||||| | |||||||| |||||||||| ||| ||||||||||||||||||||||||||||||| | | | | |||| |||| ||||||| || |
|
|
| T |
4051643 |
tttcaaccaatgtcgtgattttacagattgatgaggagattcttcaggaggtggttaataggggatttgctagggaaccattggttgactcccttaagaa |
4051544 |
T |
 |
| Q |
142 |
cagggtgcaaaatgaggtttgttccattcattttcacat-------tacatacctgcctgccagattgcttcttatt |
211 |
Q |
| |
|
|||||| ||||||||||||||| | |||||||||||||| ||| ||||||||||| ||||||||||||||| |
|
|
| T |
4051543 |
cagggtacaaaatgaggtttgtccaattcattttcacatagacacatacttacctgcctgctagattgcttcttatt |
4051467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 57 - 211
Target Start/End: Original strand, 17406058 - 17406211
Alignment:
| Q |
57 |
tgattttgcagattgatgtggacattcttcaggaggtggttaataggggatttgacaagaatcaattgattgagtcccttagcaacagggtgcaaaatga |
156 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||||||||||||||||||||||||| | | | | |||| |||||||||||| || ||| | ||||| || |
|
|
| T |
17406058 |
tgattttgcagattgatgaggagattcttcaggaggtggttaataggggatttgaaagggaaccattggttgagtcccttaagaataggatacaaaacga |
17406157 |
T |
 |
| Q |
157 |
ggtttgttccattcattttcacattacatacctgcctgccagattgcttcttatt |
211 |
Q |
| |
|
||||||| ||||||||||| || | | ||||||||| ||||||||||||||||| |
|
|
| T |
17406158 |
ggtttgtgccattcattttgac-ctgcttacctgccttccagattgcttcttatt |
17406211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University