View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10587_high_9 (Length: 250)
Name: NF10587_high_9
Description: NF10587
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10587_high_9 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 232; Significance: 1e-128; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 1 - 240
Target Start/End: Complemental strand, 49159200 - 49158961
Alignment:
| Q |
1 |
acaggttgttgatctccttgcaccataccaaagaggaggaaagattggattgtttggtggtgctggtgtaggaaaaactgtgcttattatggaacttatc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49159200 |
acaggttgttgatctccttgcaccataccaaagaggaggaaagattggattgtttggtggtgctggtgtaggaaaaactgtgcttattatggaacttatc |
49159101 |
T |
|
| Q |
101 |
aacaatgtcgcaaaggctcatggtatatatatgtgctaagtaaacatgctctcaagtattcttgttaagatgctctttaacatttgtatatatactattg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49159100 |
aacaatgtcgcaaaggctcatggtatatatatgtgctaagtaaacatgctctcaattattcttgttaagatgctctttaacatttgtatatatactattg |
49159001 |
T |
|
| Q |
201 |
tattctgtgtgtttccatttattatcaggtggtttctctg |
240 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
49159000 |
tattctgagtgtttccatttattatcaggtggtttctctg |
49158961 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 3 - 128
Target Start/End: Complemental strand, 49155134 - 49155009
Alignment:
| Q |
3 |
aggttgttgatctccttgcaccataccaaagaggaggaaagattggattgtttggtggtgctggtgtaggaaaaactgtgcttattatggaacttatcaa |
102 |
Q |
| |
|
|||||||||| || ||||||||||||||||| ||||| |||||||| ||||||||||||||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
49155134 |
aggttgttgacctgcttgcaccataccaaaggggagggaagattgggttgtttggtggtgctggtgtaggaaaaaccgttcttattatggaacttatcaa |
49155035 |
T |
|
| Q |
103 |
caatgtcgcaaaggctcatggtatat |
128 |
Q |
| |
|
|||||| || |||||||||||||||| |
|
|
| T |
49155034 |
caatgttgctaaggctcatggtatat |
49155009 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 17 - 96
Target Start/End: Original strand, 27959889 - 27959968
Alignment:
| Q |
17 |
cttgcaccataccaaagaggaggaaagattggattgtttggtggtgctggtgtaggaaaaactgtgcttattatggaact |
96 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| ||| ||||| | ||||| ||||| |||| | | ||||| |||||||| |
|
|
| T |
27959889 |
cttgcaccataccaaagaggaggaaatattgggttgattggttgcgctggggtaggcaaaagtatacttatgatggaact |
27959968 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University