View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10587_low_21 (Length: 283)
Name: NF10587_low_21
Description: NF10587
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10587_low_21 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 271; Significance: 1e-151; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 7 - 281
Target Start/End: Original strand, 45062269 - 45062543
Alignment:
| Q |
7 |
gtattttacgtttatccactcaactcactcttgggttgatggtaaataaataaatacattaaaaaataaccccactagctgtttaaatttcattttctta |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45062269 |
gtattttacgtttatccactcaactcactcttgggttgatggtaaataaataaatacattaaaaaataaccccactagctgtttaaatttcattttctta |
45062368 |
T |
|
| Q |
107 |
atcatataatgactccaatccaaccccattatcttttcttaaaatttttaggtccctttcttaatgggcctagggggtgtttaagtttatttgggatatt |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45062369 |
atcatataatgactccaatccaaccccattatcctttcttaaaatttttaggtccctttcttaatgggcctagggggtgtttaagtttatttgggatatt |
45062468 |
T |
|
| Q |
207 |
tttactgtgggattgagattgggataaaaaattaactttcatggatgtattataatttaatgagtctatcctttg |
281 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45062469 |
tttactgtgggattgagattgggataaaaaattaactttcatggatgtattataatttaatgagtctatcctttg |
45062543 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University