View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10587_low_27 (Length: 260)
Name: NF10587_low_27
Description: NF10587
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10587_low_27 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 3 - 241
Target Start/End: Original strand, 55372020 - 55372258
Alignment:
| Q |
3 |
tagtaattaatattcacaaagccagggtttttgaagttgaaaattaggcttatgtttgtggttttgttttgtgtgttggatttggaattctggctgcagg |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55372020 |
tagtaattaatattcacaaagccagggtttttgaagttgaaaattaggcttatgtttgtggttttgttttgtgtgttggatttggaattctggctgcagg |
55372119 |
T |
|
| Q |
103 |
gacagttaccgctatttcagcttttggagcacttggaattggaggtggcatttggtacttaaagaaaatgaaagctaaagcaccagtaacatgtggggtt |
202 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55372120 |
gacagttactgctatttcagcttttggagcacttggaattggaggtggcatttggtacttaaagaaaatgaaagctaaagcaccagtaacatgtggggtt |
55372219 |
T |
|
| Q |
203 |
caaagcaatgagaacaggcttttctaaatgcaaaccaac |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55372220 |
caaagcaatgagaacaggcttttctaaatgcaaaccaac |
55372258 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 135 - 230
Target Start/End: Original strand, 8516122 - 8516217
Alignment:
| Q |
135 |
ttggaattggaggtggcatttggtacttaaagaaaatgaaagctaaagcaccagtaacatgtggggttcaaagcaatgagaacaggcttttctaaa |
230 |
Q |
| |
|
|||||||||||| ||| ||||||||||| |||||| ||| ||||| |||||||| |||||||| ||||||| |||||| || || || ||||||| |
|
|
| T |
8516122 |
ttggaattggagctggtatttggtacttgaagaaattgagagctactgcaccagtcacatgtggagttcaaaccaatgataatagactattctaaa |
8516217 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University