View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10587_low_30 (Length: 251)
Name: NF10587_low_30
Description: NF10587
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10587_low_30 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 11 - 236
Target Start/End: Original strand, 50594619 - 50594844
Alignment:
| Q |
11 |
cagagaaaccgacgataatggcgacgcacgacgagcttccgatcccgatttacgataacctagagtatgtctacggcgcaggttcatctctggaagaagc |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||| |
|
|
| T |
50594619 |
cagagaaaccgacgataatggcgacgcacgacgagcttccgatcccgatttacgataacctagagcatgtttacggcgcaggttcatctctggaagaagc |
50594718 |
T |
|
| Q |
111 |
tcagcttcgtttcgatattctcaaatctaaattcgttgaaaatttcggccactctcctcaattattcgctcgttcacctggttcgaaatcatcttcgatc |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50594719 |
tcagcttcgtttcgatattctcaaatctaaattcgttgaaaatttcggtcactctcctcaattattcgctcgttcacctggttcgaaatcatcttcgatc |
50594818 |
T |
|
| Q |
211 |
attcaaattcgttatgcaattgattt |
236 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
50594819 |
attcaaattcgttatgcaattgattt |
50594844 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University