View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10587_low_32 (Length: 249)

Name: NF10587_low_32
Description: NF10587
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10587_low_32
NF10587_low_32
[»] chr4 (1 HSPs)
chr4 (157-249)||(5941219-5941311)
[»] chr2 (2 HSPs)
chr2 (59-110)||(36779993-36780044)
chr2 (16-52)||(36780061-36780097)
[»] chr8 (1 HSPs)
chr8 (59-110)||(1274455-1274506)
[»] chr7 (1 HSPs)
chr7 (59-110)||(32302953-32303004)
[»] chr3 (1 HSPs)
chr3 (16-52)||(22981179-22981215)


Alignment Details
Target: chr4 (Bit Score: 85; Significance: 1e-40; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 157 - 249
Target Start/End: Complemental strand, 5941311 - 5941219
Alignment:
157 gcgttagcgtcggatacgtcgatcatattcagtcaccggttagttctcctatctttcttgttcacgttcattgagatatgttgagagaatgaa 249  Q
    |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
5941311 gcgttagcatcggatacgtcgatcatattcagtcaccggttagttctcctatctttctcgttcacgttcattgagatatgttgagagaatgaa 5941219  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 36; Significance: 0.00000000002; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 59 - 110
Target Start/End: Complemental strand, 36780044 - 36779993
Alignment:
59 gtgttgttaaatgagactttttaatctcatccatttagttttaatctaaagg 110  Q
    ||||||| |||||| ||||||||||||||||| ||||||||||||| |||||    
36780044 gtgttgtaaaatgaaactttttaatctcatccgtttagttttaatccaaagg 36779993  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 16 - 52
Target Start/End: Complemental strand, 36780097 - 36780061
Alignment:
16 gatgaagcggttaggaagaattaaaagaggtgataga 52  Q
    ||||||||||||||||||||||||||||  |||||||    
36780097 gatgaagcggttaggaagaattaaaagaaatgataga 36780061  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 59 - 110
Target Start/End: Original strand, 1274455 - 1274506
Alignment:
59 gtgttgttaaatgagactttttaatctcatccatttagttttaatctaaagg 110  Q
    ||||||||||||||| |||||||||||||  || ||| ||||||||||||||    
1274455 gtgttgttaaatgaggctttttaatctcagtcaattaattttaatctaaagg 1274506  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 59 - 110
Target Start/End: Complemental strand, 32303004 - 32302953
Alignment:
59 gtgttgttaaatgagactttttaatctcatccatttagttttaatctaaagg 110  Q
    ||||||| |||||| ||||||||||||||||  ||||||||||||| |||||    
32303004 gtgttgtaaaatgaaactttttaatctcatctgtttagttttaatccaaagg 32302953  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 16 - 52
Target Start/End: Original strand, 22981179 - 22981215
Alignment:
16 gatgaagcggttaggaagaattaaaagaggtgataga 52  Q
    ||||||||||||||||||||||||||||  |||||||    
22981179 gatgaagcggttaggaagaattaaaagaaatgataga 22981215  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University