View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10587_low_34 (Length: 243)
Name: NF10587_low_34
Description: NF10587
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10587_low_34 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 22 - 233
Target Start/End: Complemental strand, 43392581 - 43392370
Alignment:
| Q |
22 |
cagacacccacattttgcctatactttgaccgtacagttgttgatgacatgaatttatgaacatccgtcaatgttagggttgtatagagtttcaattgaa |
121 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43392581 |
cagacacacacattttgcctatactttgaccgtacaattgttgatgacatgaatttatgaacatccgtcaatgttagggttgtatagagtttcaattgaa |
43392482 |
T |
 |
| Q |
122 |
gagaactgttgccaacacactctctttcaaccattttctctattgttggttgaaattatggcatagaaaaactattatagaatatgcatgtatttatatg |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43392481 |
gagaactgttgccaacacactctctttcaaccattttctctattgttggttgaaattatggcatagaaaaactattatagaatatgcatgtatttatatg |
43392382 |
T |
 |
| Q |
222 |
tcacaggttctg |
233 |
Q |
| |
|
|||||||||||| |
|
|
| T |
43392381 |
tcacaggttctg |
43392370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University