View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10587_low_39 (Length: 230)
Name: NF10587_low_39
Description: NF10587
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10587_low_39 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 10 - 214
Target Start/End: Complemental strand, 53807131 - 53806927
Alignment:
| Q |
10 |
gagagaagaatgaatttaacaactgaatggaacagatggaagggaatctatacaaaacaatgtgaatggacaataatggagagactgtaccaacaaaatt |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53807131 |
gagagaagaatgaatttaacaactgaatggaacagatggaagggaatctatacaaaacaatgtgaatggacaataatggagagactgtaccaacaaaatt |
53807032 |
T |
|
| Q |
110 |
ttgtccattacgtattaaaaatgaaaaacaatgttttgtccatattatccaattttgggcaccttaatcgattgattttgattgcaaagtttacggggtt |
209 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
53807031 |
ttgtccattacgtattgaaaatgaaaaacaatgttttgtccatattatccaattttgggcaacttaatcgattgattttgatagcaaagtttacggggtt |
53806932 |
T |
|
| Q |
210 |
aaaac |
214 |
Q |
| |
|
||||| |
|
|
| T |
53806931 |
aaaac |
53806927 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University