View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10587_low_40 (Length: 226)
Name: NF10587_low_40
Description: NF10587
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10587_low_40 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 160; Significance: 2e-85; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 18 - 177
Target Start/End: Original strand, 45547690 - 45547849
Alignment:
| Q |
18 |
aaaggaccgaacaaacatgatcaacgacaagacaacataccgatagataagaaacagagaaagctaaaaataaggtgaccaggggcagaattgttggagc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45547690 |
aaaggaccgaacaaacatgatcaacgacaagacaacataccgatagataagaaacagagaaagctaaaaataaggtgaccaggggcagaattgttggagc |
45547789 |
T |
 |
| Q |
118 |
cattttcatcgttgctgctggatagaatgaaatggaatcttagactaggagcttatattt |
177 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45547790 |
cattttcatcgttgctgctggatagaatgaaatggaatcttagactaggagcttatattt |
45547849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 75 - 123
Target Start/End: Original strand, 45540590 - 45540638
Alignment:
| Q |
75 |
agaaagctaaaaataaggtgaccaggggcagaattgttggagccatttt |
123 |
Q |
| |
|
||||| ||||||||||||| |||||| |||||||||||||| |||||| |
|
|
| T |
45540590 |
agaaaactaaaaataaggtagccagggacagaattgttggagtcatttt |
45540638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University