View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10587_low_43 (Length: 222)
Name: NF10587_low_43
Description: NF10587
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10587_low_43 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 87; Significance: 7e-42; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 87; E-Value: 7e-42
Query Start/End: Original strand, 1 - 110
Target Start/End: Complemental strand, 54727385 - 54727282
Alignment:
| Q |
1 |
cataatgtaggttatctttgctacacagctttatgaaatggtttaaattagtaaatactactagtattttaattttaacagcttaatgccaattatataa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54727385 |
cataatgtaggttatctttgctacacagctttatgaaatggtttaaattagtaaa------tagtattttaattttaacagcttaatgccaattatataa |
54727292 |
T |
 |
| Q |
101 |
tgaaaaatta |
110 |
Q |
| |
|
|||||||||| |
|
|
| T |
54727291 |
tgaaaaatta |
54727282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 130 - 219
Target Start/End: Complemental strand, 54714834 - 54714745
Alignment:
| Q |
130 |
ttcacactcatagctttgatccttcacaatgctgggtcttgaatcaagtaaggaagggttgaaatgcatgcatcaacccaacaaaccact |
219 |
Q |
| |
|
|||||| |||||||| |||||||||||| ||| ||||| |||| |||| |||| |||||| ||||| ||||||| |||||||| |||| |
|
|
| T |
54714834 |
ttcacaatcatagctgtgatccttcacattgcctggtctcaaatcgagtatggaatggttgacatgcacgcatcaaaccaacaaatcact |
54714745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University