View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10587_low_44 (Length: 221)
Name: NF10587_low_44
Description: NF10587
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10587_low_44 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 173; Significance: 3e-93; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 4 - 211
Target Start/End: Original strand, 39145525 - 39145741
Alignment:
| Q |
4 |
tccgcctccatatgctcgtggtctccgacattggatacgtgtgcggccatatactccttctcttttccttcgtacaaatggctctaatgaatcattttgg |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
39145525 |
tccgcctccatatgctcgtggtctccgacattggatacgtgtgcggccatatactccttctcttttccttcgttcaaatggctctaatgaatcattttgg |
39145624 |
T |
 |
| Q |
104 |
aatgatacaccacactttcc---------ctgctgctatgttttccttctcttttcttaccacatttcttgctttccgtttttacactgctgttaatgtt |
194 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
39145625 |
aatgatacaccacactttccctgctgctactgctgctatgttttccttctcttttcttaccacatttcttgctttccgtttttacaccgctgttaatgtt |
39145724 |
T |
 |
| Q |
195 |
atggcaaaggggtctta |
211 |
Q |
| |
|
|||||||||||| |||| |
|
|
| T |
39145725 |
atggcaaaggggactta |
39145741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University