View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10587_low_44 (Length: 221)

Name: NF10587_low_44
Description: NF10587
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10587_low_44
NF10587_low_44
[»] chr5 (1 HSPs)
chr5 (4-211)||(39145525-39145741)


Alignment Details
Target: chr5 (Bit Score: 173; Significance: 3e-93; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 4 - 211
Target Start/End: Original strand, 39145525 - 39145741
Alignment:
4 tccgcctccatatgctcgtggtctccgacattggatacgtgtgcggccatatactccttctcttttccttcgtacaaatggctctaatgaatcattttgg 103  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
39145525 tccgcctccatatgctcgtggtctccgacattggatacgtgtgcggccatatactccttctcttttccttcgttcaaatggctctaatgaatcattttgg 39145624  T
104 aatgatacaccacactttcc---------ctgctgctatgttttccttctcttttcttaccacatttcttgctttccgtttttacactgctgttaatgtt 194  Q
    ||||||||||||||||||||         |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||    
39145625 aatgatacaccacactttccctgctgctactgctgctatgttttccttctcttttcttaccacatttcttgctttccgtttttacaccgctgttaatgtt 39145724  T
195 atggcaaaggggtctta 211  Q
    |||||||||||| ||||    
39145725 atggcaaaggggactta 39145741  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University