View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10587_low_46 (Length: 213)
Name: NF10587_low_46
Description: NF10587
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10587_low_46 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 17 - 195
Target Start/End: Complemental strand, 7290496 - 7290318
Alignment:
| Q |
17 |
caaagggccgtatttttctattgtgatttgttatgtctatatataatgaactttttggtttgtcactccctataaatcaaaatagcactgtaatgtaacc |
116 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||| |
|
|
| T |
7290496 |
caaagggccatatttttctattgtgatttgttatgtctatatataatgaactttttggtttgtcactccctataaatcaaaataataatgtaatgtaacc |
7290397 |
T |
 |
| Q |
117 |
ttacatcaaccataacttggaccttgaaggcactaccatgcaagacataaaagataagtttattttacctaaagtatgt |
195 |
Q |
| |
|
||| ||||||||||||||||||||||||||||| |||||||||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
7290396 |
ttaaatcaaccataacttggaccttgaaggcaccaccatgcaaggcataaaagacaagtttattttacctaaagtatgt |
7290318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University