View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10587_low_48 (Length: 212)
Name: NF10587_low_48
Description: NF10587
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10587_low_48 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 8 - 198
Target Start/End: Original strand, 26000782 - 26000972
Alignment:
| Q |
8 |
agaagcaaaggtatgtagttatgattcgtaattttaaataagaagaaggtagcatagtagttttcgttgctataaaagtgacaggttgtgtcgcaatcct |
107 |
Q |
| |
|
|||| ||| |||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||| |||||||||||| |||||| | |||||| || |
|
|
| T |
26000782 |
agaaccaacggtatgtagttatgattcataattttaaatgagaagaaggtagcatagtagttttcgttactataaaagtgataggttgcggcgcaattct |
26000881 |
T |
|
| Q |
108 |
tgatcgctgttctttaatgtagttgactctccattaacacatagagacaatagaaattttccgtcaaataaggcaggcctcaaactagttg |
198 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
26000882 |
tgatcgttgttctttaatgtagttgactctccatcaacacatagagacaatagaaattttccgtcaaataaggcaggcctcaaaccagttg |
26000972 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University