View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10588_low_4 (Length: 247)
Name: NF10588_low_4
Description: NF10588
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10588_low_4 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 246
Target Start/End: Original strand, 42227524 - 42227768
Alignment:
| Q |
1 |
tgcttaacaatatagaaacaaatgaagaggcatactttgtgtaagttgttgtattgacttttgagcatatgatttggcaaccctttatagaagatgagta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42227524 |
tgcttaacaatatagaaacaaatgaagaggcatactttgtgtcagttggtgtat-gacttttgagcatatgatttggcaaccctttatagaagatgagta |
42227622 |
T |
 |
| Q |
101 |
ctattttcatgctatgatgttgggtccaaactaattttgttgtatgagttcgaatatctcttgtgctccctttaataaaaagtttgcttatcgaaaataa |
200 |
Q |
| |
|
| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
42227623 |
caattttcctgctatgatgttgggtccaaactaattttgttgtatgagttcgaatatctcttgtactccctttattaaaaagtttgcttatcgaaaataa |
42227722 |
T |
 |
| Q |
201 |
ctcatatttgtatagctccctcagtcacaacttccctttgcttctc |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
42227723 |
ctcatatttgtatagctccctcagtcacaacttccctttgtttctc |
42227768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University